[bam] MD tag and cigar

MD tag and cigar

10A5^AC6

REF:         ATCGTAGCTAATTTGGACATCGGT

READ:        ATCGTAGCTATTTTGG--ATCGGT

MD TAG:      10        A5   ^AC6

CIGAR:       16M             2D6M

READ:        atcGTAGCTATTTTGGATA..GGT (ATCGTAGCTATTTTGGATAAAGGT)

MD TAG:      17               C1TC3

CIGAR:       3S 16M             2N3M

READ:        ATCGTAGCTAATTTGGACATCGGT (ATCGTGGAGCTAATTTGGACATCGGT)

CIGAR:       5M   2I19M

MD TAG

The MD eld aims to achieve SNP/indel calling without looking at the reference. For example, a string `10A5^AC6' means from the leftmost reference base in the alignment, there are 10 matches followed by an A on the reference which is di erent from the aligned read base; the next 5 reference bases are matches followed by a 2bp deletion from the reference; the deleted sequence is AC; the last 6 bases are matches. The MD eld ought to match the CIGAR string.

CIGAR

M     alignment match (can be a sequence match or mismatch)

I     insertion to the reference

D     deletion from the reference

N     skipped region from the reference

S     soft clipping (clipped sequences present in SEQ)

H     hard clipping (clipped sequences NOT present in SEQ)

P     padding (silent deletion from padded reference)

=     sequence match

X     sequence mismatch

H can only be present as the rst and/or last operation.

S may only have H operations between them and the ends of the CIGAR string.

For mRNA-to-genome alignment, an N operation represents an intron. For other types of alignments, the interpretation of N is not de ned.

Sum of lengths of the M/I/S/=/X operations ought to equal the length of SEQ.